Building a probe set (atlas {make-probes, dump-probes})
You can create a variant probe set in two ways.
1. 'Dumping' the Variant database
atlas dump-probes
usage: atlas dump-probes [-h] [--db_name db_name] [-q] [--kmer kmer] [--force]
[-v]
reference_filepath
positional arguments:
reference_filepath reference_filepath
optional arguments:
-h, --help show this help message and exit
--db_name db_name db_name
-q, --quiet do not output warnings to stderr
--kmer kmer kmer length
--force
-v, --verbose
atlas dump-probes reference_set.fasta > variant_probe_set.fasta
This will generate a probe set for each variant in the database. The resulting fasta file will look like the following:
>ref-37d2eea6a23d526cbee4e00b901dc97885a88e7aa8721432b080dcc342b459ce?num_alts=10&ref=56cf2e4ca9fefcd2b15de4d6
TCGCCGCAGCGGTTGGCAACGATGTGGTGCGATCGCTAAAGATCACCGGGCCGGCGGCACCAT
...
TCGCCGCAGCGGTTGGCAACGATGTGGTGCAATCGCTAAAGATCACCGGGCCGGCGGCATCAT
>alt-37d2eea6a23d526cbee4e00b901dc97885a88e7aa8721432b080dcc342b459ce
TCGCCGCAGCGGTTGGCAACGATGTGGTGCAATCGCTAAAGATCACCGGGCCGGCGGCACGAT
>ref-2dab6387a677ac17f6bc181f47235a4196885723b34ceff3a05ffcbfd6834347?num_alts=10&ref=56cf2e4ca9fefcd2b15de4d6
CTGTCGCTGGGAAGAGCGAATACGTCTGGACCAGGACGGGCTACCCGAACACGATATCTTTCG
>alt-2dab6387a677ac17f6bc181f47235a4196885723b34ceff3a05ffcbfd6834347
...
Where you have a series of variants represented as a set of alleles. The reference allele followed by multiple alternate alleles. You will end up with multiple alternate alleles if there are other variants that fall within k of the target variant.
Each variant is referenced by a var_hash with is the hash of ":ref:pos:alt" which is indexed in the database and can be used to query for Variant object.
See atlas genotype to use these probes to genotype a new sample.
2. Building a custom probe set
atlas make-probes allows you to build a probe set using Variants that are not already in the database.
usage: atlas make-probes [-h] [--db_name db_name] [-q] [-v VARIANT] [-f FILE]
[-g GENBANK] [-k KMER] [--no-backgrounds]
reference_filepath
positional arguments:
reference_filepath reference_filepath
optional arguments:
-h, --help show this help message and exit
--db_name db_name db_name
-q, --quiet do not output warnings to stderr
-v VARIANT, --variant VARIANT
Variant in DNA positions e.g. A1234T
-f FILE, --file FILE File containing variants as rows A1234T
-g GENBANK, --genbank GENBANK
Genbank file containing genes as features
-k KMER, --kmer KMER kmer length
--no-backgrounds Build probe set against reference only ignoring nearby
variants
Example usages:
Build a variant probe set defined based on reference co-ordinates (1-based)
First, define your variants for which you want to build probes. Columns are
ref/gene pos ref alt alphabet
ref 2522798 G T DNA
ref 3785555 A G DNA
ref 839793 C A DNA
ref 2734398 C G DNA
ref 3230861 T A DNA
ref 1018694 A T DNA
atlas make-probes --db_name :db_name -f variants.txt ref.fa > variant_probe_set.fa
Build a variant probe set defined based on gene co-ordinates (1-based)
You can also define your variants in terms of gene coordinates in amino acid or DNA space.
rpoB S431X PROT
rpoB F425X PROT
embB M306X PROT
rrs C513X DNA
gyrA D94X PROT
gid P75L PROT
gid V88A PROT
katG S315X PROT
To do this you must provide a genbank file defining the position of the variants in the reference (-g (GENBANK) )
atlas make-probes --db_name :db_name -f aa_variants.txt -g ref.gb ref.fa> gene_variant_probe_set.fa
Updated less than a minute ago