Building a probe set (atlas {make-probes, dump-probes})

You can create a variant probe set in two ways.

1. 'Dumping' the Variant database

atlas dump-probes

Text

usage: atlas dump-probes [-h] [--db_name db_name] [-q] [--kmer kmer] [--force]
                         [-v]
                         reference_filepath

positional arguments:
  reference_filepath  reference_filepath

optional arguments:
  -h, --help          show this help message and exit
  --db_name db_name   db_name
  -q, --quiet         do not output warnings to stderr
  --kmer kmer         kmer length
  --force
  -v, --verbose

Shell

atlas dump-probes reference_set.fasta > variant_probe_set.fasta

This will generate a probe set for each variant in the database. The resulting fasta file will look like the following:

Text

>ref-37d2eea6a23d526cbee4e00b901dc97885a88e7aa8721432b080dcc342b459ce?num_alts=10&ref=56cf2e4ca9fefcd2b15de4d6
TCGCCGCAGCGGTTGGCAACGATGTGGTGCGATCGCTAAAGATCACCGGGCCGGCGGCACCAT
...
TCGCCGCAGCGGTTGGCAACGATGTGGTGCAATCGCTAAAGATCACCGGGCCGGCGGCATCAT
>alt-37d2eea6a23d526cbee4e00b901dc97885a88e7aa8721432b080dcc342b459ce
TCGCCGCAGCGGTTGGCAACGATGTGGTGCAATCGCTAAAGATCACCGGGCCGGCGGCACGAT
>ref-2dab6387a677ac17f6bc181f47235a4196885723b34ceff3a05ffcbfd6834347?num_alts=10&ref=56cf2e4ca9fefcd2b15de4d6
CTGTCGCTGGGAAGAGCGAATACGTCTGGACCAGGACGGGCTACCCGAACACGATATCTTTCG
>alt-2dab6387a677ac17f6bc181f47235a4196885723b34ceff3a05ffcbfd6834347
...

Where you have a series of variants represented as a set of alleles. The reference allele followed by multiple alternate alleles. You will end up with multiple alternate alleles if there are other variants that fall within k of the target variant.

Each variant is referenced by a var_hash with is the hash of ":ref:pos:alt" which is indexed in the database and can be used to query for Variant object.

See atlas genotype to use these probes to genotype a new sample.

2. Building a custom probe set

atlas make-probes allows you to build a probe set using Variants that are not already in the database.

Text

usage: atlas make-probes [-h] [--db_name db_name] [-q] [-v VARIANT] [-f FILE]
                         [-g GENBANK] [-k KMER] [--no-backgrounds]
                         reference_filepath

positional arguments:
  reference_filepath    reference_filepath

optional arguments:
  -h, --help            show this help message and exit
  --db_name db_name     db_name
  -q, --quiet           do not output warnings to stderr
  -v VARIANT, --variant VARIANT
                        Variant in DNA positions e.g. A1234T
  -f FILE, --file FILE  File containing variants as rows A1234T
  -g GENBANK, --genbank GENBANK
                        Genbank file containing genes as features
  -k KMER, --kmer KMER  kmer length
  --no-backgrounds      Build probe set against reference only ignoring nearby
                        variants

Example usages:

Build a variant probe set defined based on reference co-ordinates (1-based)

First, define your variants for which you want to build probes. Columns are

ref/gene pos ref alt alphabet

variants.txt

ref     2522798 G       T       DNA
ref     3785555 A       G       DNA
ref     839793  C       A       DNA
ref     2734398 C       G       DNA
ref     3230861 T       A       DNA
ref     1018694 A       T       DNA

Shell

atlas make-probes --db_name :db_name -f variants.txt ref.fa > variant_probe_set.fa

Build a variant probe set defined based on gene co-ordinates (1-based)

You can also define your variants in terms of gene coordinates in amino acid or DNA space.

aa_variants.txt

rpoB    S431X   PROT
rpoB    F425X   PROT
embB    M306X   PROT
rrs     C513X   DNA
gyrA    D94X    PROT
gid     P75L    PROT
gid     V88A    PROT
katG    S315X   PROT

To do this you must provide a genbank file defining the position of the variants in the reference (-g (GENBANK) )

Shell

atlas make-probes --db_name :db_name -f aa_variants.txt -g ref.gb  ref.fa> gene_variant_probe_set.fa